AT2 iPSCs were produced in our laboratory utilizing the CytoTune-iPS 2.0 Sendai Reprogramming Kit (cat. A16517; Invitrogen, Waltham, MA, USA), while UCB iPSCs (CMC11 cells) were kindly provided by Dr. Ji-Hyun Joo (YiPSCELL Corporation, Seoul, South Korea) [22]. The cells were maintained in mTeSR E8 medium (cat. 05990; STEMCELL Technologies, Vancouver, BC, Canada) on vitronectin-coated surfaces (cat. A31804; Gibco, Waltham, MA, USA). Upon reaching 80% confluence, the cells were subcultured. For this process, the cells were dissociated using TrypLE Select Enzyme (cat. 12563029; Gibco) and subsequently transferred to a fresh vitronectin-coated dish. Following subculturing, the cells were treated with the ROCK inhibitor, 10 µM Y-27632 (cat. 1254; TOCRIS, Bristol, UK) in mTeSR E8 medium. After 1 to 2 days, the mTeSR E8 medium was replaced daily.

When 60% of the cells were placed in the incubated iPSC dish, the STEMdiff Definitive Endoderm Kit (cat. 05110; STEMCELL Technologies) was used to differentiate the cells into the endoderm. Differentiated endoderm cells were dissociated using the TrypLE Select Enzyme (cat. 12563029; Gibco). The dissociated suspension cells were distributed in dome form in culture dishes by adding 3×10⁴ cells in Matrigel (cat. 356231; Corning Incorporated, Corning, NY, USA) (30 μL) and a small airway epithelial cell growth medium bullet kit (SAGM) (cat. CC-3118; Lonza, Basel, Switzerland) (20 μL). The cell-gel mixture was incubated at 37°C in a CO₂ incubator for 30 minutes to allow gelation. Next, the cells were incubated with SAGM for 7 days. The medium was changed once every 2 days. After 7 days, the medium was replaced with alveolar differentiation medium (Table 1), and the medium was changed once every 2 days. The cells formed spheroids, which continued to grow in Matrigel and lost their spheroid shape depending on the cell growth rate and population. During this time, the spheroids dissociated into single cells using Accutase (cat. 25-058-CI; Corning Incorporated), and a Matrigel dome was created. We removed the Matrigel dome containing spheroids from the culture dish, transferred it to a 15-mL tube, and washed it with cold phosphate-buffered saline (PBS). We then removed the PBS and treated the cells with Accutase (cat. 25-058-CI; Corning Incorporated) and incubated them at 37°C in a CO₂ incubator until the spheroids were released into single cells. The single cells were again divided into 60 mm culture dishes by adding 3×10⁴ cells/20 μL in a Matrigel dome, 30 μL+SAGM. The re-domed cells were cultured in SAGM for the first 7 days and then replaced with alveolar differentiation medium. Re-doming was repeated until a perfect alveolar spheroid was maintained.

All samples were fixed in 4% (v/v) paraformaldehyde overnight at 4°C and washed with PBS. For immunocytochemical staining, fixed samples were permeabilized using 0.5% TritonX-100 (cat. TR1020-500-00; Dawonscience, Suwon, South Korea) in PBS for 20 minutes at room temperature and then washed with PBS. Samples were incubated with primary antibodies (1:200-500 dilution) with 5% normal goat serum in PBS for 24 hours at 4°C and washed with PBS. After incubation with the primary antibodies, the samples were incubated with fluorescently labeled secondary antibodies (1:200-500 dilution), goat anti-rabbit Alexa Fluor488 (cat. A11008; Invitrogen), or goat anti-mouse Alexa Fluor546 (cat. A11003; Invitrogen), in 5% normal goat serum in PBS for 1 hour at room temperature, washed with PBS, and stained with Hoechst 33342 (cat. H3570, Invitrogen). Images were obtained using a confocal microscope (ZEISS LSM 800 with Airyscan; Carl Zeiss, Oberkochen, Germany). The antibodies used in this study were anti-OCT3/4 (cat. sc-5279; Santa Cruz Biotechnology, Dallas, TX, USA), anti-SSEA4 (cat. MAB4304; Sigma-Aldrich, St. Louis, MO, USA), anti-TRA-1-60 (cat. sc-21705; Santa Cruz Biotechnology), anti-TRA-1-81 (cat. MAB4381; Sigma-Aldrich), anti-HT2-280 (cat. TB-27AHT2-280; TERRACE BIOTECH, San Francisco, CA, USA), anti-Caveolin-1(cat. ab2910; Abcam Inc., Cambridge, UK), and anti-aquaporin-5 (cat. ab92320, Abcam Inc.).

Total RNA from organoids was extracted using the TRIzol reagent (cat. 15596018; Invitrogen) according to the standard TRIzol protocol. cDNA synthesis was performed using the iScript cDNA Synthesis Kit (cat. 1708890; Bio-Rad, Hercules, CA, USA) following the standard protocol in a SimpliAmp Thermal Cycler (cat. A24811; Thermo Fisher Scientific, Waltham, MA, USA). Quantitative real-time polymerase chain reaction (RT-PCR) was performed, and signals were detected using a C1000 Touch Thermal Cycler (cat. 1851197; Bio-Rad) following the manufacturer’s instructions. Quantitative RT-PCR was performed on cDNA samples using an iQ SYBR Green Supermix (cat. 1708880; Bio-Rad). The PCR primers used were as follows: OCT4 (forward, 5′ ACCCCTGGTGCCGTGAA 3′ and reverse 5′ GGCTGAATACCTTCCCAAATA 3′), SOX2 (forward, 5′ ATGGGTTCGGTGGTCAAGTC 3′ and reverse 5′ CTGATCATG TCCCGGAGGTC 3′), LIN28 (forward, 5′ GTTCGGCTTCCTGTCCAT 3′ and reverse 5′ CTG CCTCACCCTCCTTCA 3′), NANOG (forward, 5′ GATTTGTGGGCCTGAAGAAA 3′ and reverse 5′ CAGATCCATGGAGGAAGGAA 3′), GAPDH (forward, 5′ ACCCACTCCTCCACC TTTGA 3′ and reverse 5′ CTGTTGCTGTAGCCAAATTCGT 3′), CXCR4 (forward, 5′ TTCC CACGCCTGCCTAAATA 3′ and reverse 5′ GACCGCATTCTCTTTACCCACT 3′), SOX17 (forward, 5′ CAAGATGCTGGGTGAGTCCG 3′ and reverse 5′ CTCGCAAAGAACAGTTTG GGG 3′), FOXA2 (forward, 5′ AAGACGAGCGCTTACCTCG 3′ and reverse 5′ GCACTCGG CTTCCAGTATG 3′), NKX2.1 (forward, 5′ ACGCCGATCTTGTTGGATGTA 3′ and reverse 5′ GGCTAAAACAAACGCGAGGC 3′), and CPM (forward, 5′ GCTGTTGCTGCCTTTGGTAG 3′ and reverse 5′ GGCAACAGTCTTCAAAAACGC 3′).

Flow cytometric analysis of SOX17, FOXA2, and SOX2 expression in endoderm cells from AT2 and UCB iPSCs was performed. The cells were fixed using BD Cytofix/Cytoperm Fixation and Permeabilization Solution (cat. 51-2090 KE; BD Biosciences, Franklin Lakes, NJ, USA) for 15 minutes at room temperature. All subsequent washing steps were performed in PBS, and centrifugation was performed at 300×g for 3 minutes to obtain cell pellets. Each cell was permeabilized and blocked in 0.5% TritonX-100 in PBS for 30 minutes, followed by washing. The cells were incubated with primary antibodies (1:200-500 diluted in 50 µL of PBS), Anti-CXCR4 (cat. ab58176; Abcam Inc.), anti-SOX17 (cat. MAB19241; R&D Systems, Minneapolis, MN, USA), anti-FOXA2 (cat. ab108422; Abcam Inc.), and anti-SOX2 (cat. ab97959; Abcam Inc.). Secondary antibodies were 1:500 diluted in 50 µL of PBS for SOX17, FOXA2, and SOX2. Goat anti-rabbit Alexa Fluor488 and goat anti-mouse Alexa Fluor546 were added, and the cells were incubated for 20 minutes in the dark. Finally, the cells were passed through a 35-µm cell strainer cap in a 5 mL round-bottom Falcon tube (cat. 352235; Corning Incorporated) to prevent the blocking of fluorescence-activated cell sorting (FACS) lines by cell aggregates. Samples were analyzed using a BD FACS Canto II (BD Biosciences).

Before generating alveolar organoids, we generated AT2 iPSCs and showed that they could be a good candidate material for alveolar organoids. First, human lung tissue-derived AT2 cells were reprogrammed into iPSCs using the Sendai viral transduction method, as previously described in detail. To confirm that the AT2 iPSC cell line is a suitable cell source to obtain alveolar organoids, we utilized an iPSC cell line comparable to UCB iPSCs, specifically the CMC iPSC cell line mentioned in several other studies involving cell sources for brain and kidney organoids [23,24]. Therefore, 2 independent cell lines were analyzed for their pluripotency. We examined the similarities in iPSC characterization between iPSCs using various methods, including cell culture morphology, immunostaining, and RT-PCR analysis of iPSC-specific marker expression. Both AT2 iPSCs and UCB iPSCs displayed typical iPSC characteristics, such as a round shape, large nucleus, scant cytoplasm, and the formation of sharp-edged, flat, and tightly packed colonies. Each iPSC line was maintained for 20 passages without any noticeable phenotypic changes (Fig. 1A). The expression of iPSC-specific markers was determined at both the gene and protein levels. Both AT2 and UCB iPSCs expressed OCT3/4, SSEA4, TRA-1-60, and TRA-1-81, which are commonly used iPSC markers. Furthermore, both iPSC lines expressed genes such as OCT4, SOX2, LIN28, and NANOG at higher levels than their respective derived cells (Fig. 1B and 1C).

Several recent studies have reported protocols for generating airway and alveolar organoids using iPSCs, which involve reprogramming fibroblasts [20,25,26]. Many alveolar organoid protocols also require a cell sorting step, because iPSC differentiation is not efficient enough to progress to the next cell stage (Table 2) [20,21,26,27]. Therefore, in this study, we sought to establish iPSC-derived alveolar organoids without the cell sorting step in which full compartment cells are present in a culture using AT2 and UCB iPSCs. Here, we optimized a step-by-step differentiation protocol to generate iPSC-derived alveolar organoids (Fig. 2A). First, the iPSCs were differentiated into a DE, which was induced using STEMdiff Definitive Endoderm Kit. Following efficient differentiation of DE cells, the cells were further differentiated into AFE, LP cells, AT cells, and alveolar organoids in SAGM and alveolar differentiation media. The differentiated endoderm cells from each iPSC type were maintained as single cells in a three-dimensional Matrigel dome environment and were induced to differentiate into alveolar organoids (Fig. 2B). As a result, differentiation continued for 40 days, and alveolar organoids were successfully formed (Fig. 2B) in AT2 iPSC-origin cells.

We investigated how different iPSC cell lines differentiated into alveolar organoids using the same protocol. When placed into this culture system, alveolar spheroids derived from cultured AT2 iPSCs developed into alveolar organoids in the Matrigel dome, but UCB iPSCs did not form spheroids (Fig. 3A). The alveolar organoids derived from AT2 iPSCs expressed the type 1 alveolar markers caveolin-1 and aquaporin 5, as well as the type 2 alveolar marker HT2-280, whereas these markers were not expressed in UCB iPSC-derived organoids (Fig. 3B). These results suggest that the source of iPSCs can affect the differentiation process and the resulting final differentiated alveolar cell types. To understand the response of each iPSC line in differentiating alveolar organoids cultured using the same protocol, we began by testing conditions to improve DE differentiation efficiency. To determine whether this difference occurred when each iPSC differentiated into DE cells, we compared the gene and protein expression of endoderm markers. Using flow cytometry with SOX17, FOXA2, and SOX2 to quantitate cell composition, we observed no difference in the expression of the protein markers SOX17 and FOXA2 in either cell line. SOX2-positive cell populations are candidates for bud tip-like progenitors, a developmentally transient progenitor population for airway and alveolar cell types. The expression of SOX2 protein was higher in AT2 iPSCs (72.6%) than in UCB iPSCs (5.1%) at the DE stage (Fig 3C). Then we performed additional experiments assessing the protein CXCR4 using flow cytometry in the ED stage. The analysis revealed a higher abundance of CXCR4 protein in AT2 iPSCs (84.3%) have a greater component of proteins associated with lung development compared to UCB iPSCs (1.3%) (Fig 3C). These cells already have a potential committed progenitor to the differentiated foregut stage when triggered by specific cytokines. Under the same cell conditions, each ED cell was analyzed using RT-PCR. The expression difference of endoderm marker CXCR4 showed a statistically significant variation , and the expression of other genes (SOX17, FOXA2, and SOX2 was slightly higher in the differentiated endoderm cells compare to their respective iPSCs (Fig 3D).

Although the protein expression of SOX2 differed between AT2 and UCB iPSCs, there was no significant difference in the gene expression of SOX2 in differentiated endoderm cells (Fig. 3C and 3D). The higher protein expression of SOX2 in AT2 iPSCs suggests that the cells were already committed progenitors of the AFE, as reflected by the similar RNA levels between the 2 iPSC types. The expression of lung progenitor genes, such as NKX2.1 and CPM, was significantly higher in endoderm cells differentiated from AT2 iPSCs than in those differentiated from UCB iPSCs (Fig. 3D). The results strongly suggested that, based on the gene expression data and the observed differences in alveolar organoid formation and protein marker expression, the differentiation of AT2 iPSCs appeared to be more committed toward the alveolar cell lineage than UCB iPSCs. This may explain the observed differences in organoid formation and marker expression between the 2 cell types.