Organoid > Volume 3; 2023 > Article
Lim, Jo, and Kim: A novel method for generating induced pluripotent stem cell (iPSC)-derived alveolar organoids: a comparison of their ability depending on iPSC origin

Abstract

Background

Alveolar organoids may be useful tools in drug discovery for lung diseases, such as chronic obstructive pulmonary disease, and for studying the effects of respiratory viruses, such as severe acute respiratory syndrome coronavirus 2. Induced pluripotent stem cell (iPSC)-derived alveolar organoids offer ethical and cost-effective alternatives to animal testing and primary cell-based methods. In this study, we present generating alveolar organoids from iPSCs and compare the efficiency of generating iPSCs from alveolar type 2 (AT2) and umbilical cord blood (UCB) cells.

Methods

The protocol started with a two-dimensional culture and transitioned to a three-dimensional culture using Matrigel after the endoderm stage. Organoid cultivation lasted for at least 40 days, and the characteristics of alveolar organoids were assessed using flow cytometry, real-time polymerase chain reaction, and immunostaining.

Results

iPSCs derived from AT2 cells showed a better ability to generate alveolar organoids than those derived from UCB cells. This difference in the ability of AT2 iPSCs and UCB iPSCs to generate alveolar organoids appeared during the definitive endoderm differentiation stage. AT2 iPSCs showed higher expression of the anterior foregut endoderm marker SOX2 and lung progenitor gene expression markers, such as NKX2.1 and CPM, which are associated with the lung progenitor differentiation stage.

Conclusion

This protocol successfully generated alveolar organoids from AT2 iPSCs; however, the efficiency of differentiation varied depending on the origin of the iPSCs. This study also found differences in gene expression and developmental potential between iPSCs, which may have contributed to the observed differences in differentiation efficiency.

Introduction

Lung damage can lead to various pulmonary diseases caused by bacteria, viruses, and environmental pollutants. Common examples include pneumonia, tuberculosis, chronic obstructive pulmonary disease, and lung cancer. Viruses, such as influenza and coronaviruses, induce changes in the composition of lung cell components, ultimately leading to failure of lung function and consequently causing lung disease [1]. Several lung diseases can result in lung tissue fibrosis, which results from interactions among epithelial cells, immune cells, and fibroblasts [2]. Fibrosis can occur due to continuous inflammatory reactions and repeated damage, which can cause chronic inflammation, difficulty breathing, and ultimately lead to death [3]. The World Health Organization identified chronic lung disease as one of the top 10 causes of death in 2021 [4]. Despite significant investment in research to identify treatment options, there are currently no effective treatments that address the causes of these illnesses and delay disease progression, and treatment is mainly focused on relieving symptoms [5]. Lung organoids are being studied as a potential solution to this problem, as they can provide an effective means of drug discovery without the financial and ethical issues associated with animal experiments and with the advantage of greater tissue similarity than in cell therapy [6,7].
Various methods for manufacturing organoids have been reported, including those for the intestines, liver, lungs, brain, kidneys, and pancreas, which are actively used in research [6,8]. These organoids can be prepared using primary cells isolated from tissues or reprogrammed induced pluripotent stem cells (iPSCs) [7,9,10]. The differentiation of iPSCs into specific cell types involves the activation or suppression of various signaling pathways and the use of specific differentiation techniques to induce the expression of genes associated with a particular cell lineage. The development of lung cells from iPSCs typically involves differentiation through anterior foregut endoderm (AFE) and lung progenitor (LP) cells, which can be influenced by various signaling pathways, such as Wnt and Smad [11-14]. For iPSCs to differentiate into the endoderm, Wnt signaling must be activated by treating cells with CHIR-99021 and activin A. The next step is to treat the cells with noggin, dorsomorphin, and SB-431542 to suppress bone morphogenetic proteins (BMPs) and transforming growth factor-beta signals, thereby differentiating them from the endoderm to the AFE [11-14]. When BMPs and Wnt signals are activated and fibroblast growth factor treatment is applied, the cells differentiate into the LP state and further differentiate into cells that constitute the lung under regulation through Wnt signaling [11,13,14]. In addition, alveolar organoid differentiation requires the regulation of signaling pathways and appropriate physical conditions for cultivation. The physical conditions for cultivation, such as the conversion of cells from a two-dimensional to a three-dimensional culture within the extracellular matrix, are also important for the differentiation of iPSCs into alveolar organoids.
Human PSC (hPSC) studies on lung organoids or airway and alveolar organoids have focused on bud tip progenitors obtained from the human fetal lung [15-19]. Despite these studies, hPSC-derived organoids from human fetal tissue are not broadly accessible to the research community and are associated with ethical and regulatory challenges, highlighting the importance of iPSC-derived lung models. Alveolar organoids containing alveolar type (AT)-specific cells derived from iPSCs are obtained by cell-sorting of NKX2.1-positive cells and the differentiation of NKX2.1+ cells using a combination of cytokines and inhibitors [20]. Another method of induction and stable expansion of SFTPC+ cell populations suggests that the niche provided by epithelial-mesenchymal interactions may be crucial for maintaining the progenitor properties of AT2 cells [21]. Herein, we describe our method for generating and cultivating alveolar organoids for comparison with different tissue-origin iPSC lines. We incubated the cells in a three-dimensional culture using Matrigel at the definitive endoderm (DE) stage, which produces alveolar organoids that differ from those generated using other methods. Furthermore, the use of iPSCs derived from different cell types, such as AT2 and umbilical cord blood (UCB) cells, can influence their ability to differentiate into alveolar organoids. When attempting to generate specific cell types or organoids, it is important to select the appropriate cell type for reprogramming and differentiation. We observed differences in the ability to form spheroids and differentiate into alveolar cells, depending on the source of iPSCs. The variation in sex-determining region Y-box 2 (SOX2) expression at the AFE stage may be one reason for the differences in differentiation potential between various iPSC lines. Therefore, this study characterizes AT2-derived iPSCs as primarily composed of LP cells, with the exception of the sorting of specific cell types and the alveolar organoid method used to differentiate LP cells from AT2 iPSCs. This model can be readily employed to study lung development and serves as a proof-of-concept for cellular engineering and cell therapy.

Materials and Methods

Ethics statement: This study was approved by Institutional Review Board (IRB) of The Catholic University of Korea, Seoul St. Mary’s Hospital (IRB number: KC18TNSI0033).

1. Cell culture

AT2 iPSCs were produced in our laboratory utilizing the CytoTune-iPS 2.0 Sendai Reprogramming Kit (cat. A16517; Invitrogen, Waltham, MA, USA), while UCB iPSCs (CMC11 cells) were kindly provided by Dr. Ji-Hyun Joo (YiPSCELL Corporation, Seoul, South Korea) [22]. The cells were maintained in mTeSR E8 medium (cat. 05990; STEMCELL Technologies, Vancouver, BC, Canada) on vitronectin-coated surfaces (cat. A31804; Gibco, Waltham, MA, USA). Upon reaching 80% confluence, the cells were subcultured. For this process, the cells were dissociated using TrypLE Select Enzyme (cat. 12563029; Gibco) and subsequently transferred to a fresh vitronectin-coated dish. Following subculturing, the cells were treated with the ROCK inhibitor, 10 µM Y-27632 (cat. 1254; TOCRIS, Bristol, UK) in mTeSR E8 medium. After 1 to 2 days, the mTeSR E8 medium was replaced daily.

2. Alveolar organoid differentiation from iPSCs

When 60% of the cells were placed in the incubated iPSC dish, the STEMdiff Definitive Endoderm Kit (cat. 05110; STEMCELL Technologies) was used to differentiate the cells into the endoderm. Differentiated endoderm cells were dissociated using the TrypLE Select Enzyme (cat. 12563029; Gibco). The dissociated suspension cells were distributed in dome form in culture dishes by adding 3×104 cells in Matrigel (cat. 356231; Corning Incorporated, Corning, NY, USA) (30 μL) and a small airway epithelial cell growth medium bullet kit (SAGM) (cat. CC-3118; Lonza, Basel, Switzerland) (20 μL). The cell-gel mixture was incubated at 37°C in a CO2 incubator for 30 minutes to allow gelation. Next, the cells were incubated with SAGM for 7 days. The medium was changed once every 2 days. After 7 days, the medium was replaced with alveolar differentiation medium (Table 1), and the medium was changed once every 2 days. The cells formed spheroids, which continued to grow in Matrigel and lost their spheroid shape depending on the cell growth rate and population. During this time, the spheroids dissociated into single cells using Accutase (cat. 25-058-CI; Corning Incorporated), and a Matrigel dome was created. We removed the Matrigel dome containing spheroids from the culture dish, transferred it to a 15-mL tube, and washed it with cold phosphate-buffered saline (PBS). We then removed the PBS and treated the cells with Accutase (cat. 25-058-CI; Corning Incorporated) and incubated them at 37°C in a CO2 incubator until the spheroids were released into single cells. The single cells were again divided into 60 mm culture dishes by adding 3×104 cells/20 μL in a Matrigel dome, 30 μL+SAGM. The re-domed cells were cultured in SAGM for the first 7 days and then replaced with alveolar differentiation medium. Re-doming was repeated until a perfect alveolar spheroid was maintained.

3. Immunocytochemistry

All samples were fixed in 4% (v/v) paraformaldehyde overnight at 4°C and washed with PBS. For immunocytochemical staining, fixed samples were permeabilized using 0.5% TritonX-100 (cat. TR1020-500-00; Dawonscience, Suwon, South Korea) in PBS for 20 minutes at room temperature and then washed with PBS. Samples were incubated with primary antibodies (1:200-500 dilution) with 5% normal goat serum in PBS for 24 hours at 4°C and washed with PBS. After incubation with the primary antibodies, the samples were incubated with fluorescently labeled secondary antibodies (1:200-500 dilution), goat anti-rabbit Alexa Fluor488 (cat. A11008; Invitrogen), or goat anti-mouse Alexa Fluor546 (cat. A11003; Invitrogen), in 5% normal goat serum in PBS for 1 hour at room temperature, washed with PBS, and stained with Hoechst 33342 (cat. H3570, Invitrogen). Images were obtained using a confocal microscope (ZEISS LSM 800 with Airyscan; Carl Zeiss, Oberkochen, Germany). The antibodies used in this study were anti-OCT3/4 (cat. sc-5279; Santa Cruz Biotechnology, Dallas, TX, USA), anti-SSEA4 (cat. MAB4304; Sigma-Aldrich, St. Louis, MO, USA), anti-TRA-1-60 (cat. sc-21705; Santa Cruz Biotechnology), anti-TRA-1-81 (cat. MAB4381; Sigma-Aldrich), anti-HT2-280 (cat. TB-27AHT2-280; TERRACE BIOTECH, San Francisco, CA, USA), anti-Caveolin-1(cat. ab2910; Abcam Inc., Cambridge, UK), and anti-aquaporin-5 (cat. ab92320, Abcam Inc.).

4. Quantitative real-time polymerase chain reaction

Total RNA from organoids was extracted using the TRIzol reagent (cat. 15596018; Invitrogen) according to the standard TRIzol protocol. cDNA synthesis was performed using the iScript cDNA Synthesis Kit (cat. 1708890; Bio-Rad, Hercules, CA, USA) following the standard protocol in a SimpliAmp Thermal Cycler (cat. A24811; Thermo Fisher Scientific, Waltham, MA, USA). Quantitative real-time polymerase chain reaction (RT-PCR) was performed, and signals were detected using a C1000 Touch Thermal Cycler (cat. 1851197; Bio-Rad) following the manufacturer’s instructions. Quantitative RT-PCR was performed on cDNA samples using an iQ SYBR Green Supermix (cat. 1708880; Bio-Rad). The PCR primers used were as follows: OCT4 (forward, 5′ ACCCCTGGTGCCGTGAA 3′ and reverse 5′ GGCTGAATACCTTCCCAAATA 3′), SOX2 (forward, 5′ ATGGGTTCGGTGGTCAAGTC 3′ and reverse 5′ CTGATCATG TCCCGGAGGTC 3′), LIN28 (forward, 5′ GTTCGGCTTCCTGTCCAT 3′ and reverse 5′ CTG CCTCACCCTCCTTCA 3′), NANOG (forward, 5′ GATTTGTGGGCCTGAAGAAA 3′ and reverse 5′ CAGATCCATGGAGGAAGGAA 3′), GAPDH (forward, 5′ ACCCACTCCTCCACC TTTGA 3′ and reverse 5′ CTGTTGCTGTAGCCAAATTCGT 3′), CXCR4 (forward, 5′ TTCC CACGCCTGCCTAAATA 3′ and reverse 5′ GACCGCATTCTCTTTACCCACT 3′), SOX17 (forward, 5′ CAAGATGCTGGGTGAGTCCG 3′ and reverse 5′ CTCGCAAAGAACAGTTTG GGG 3′), FOXA2 (forward, 5′ AAGACGAGCGCTTACCTCG 3′ and reverse 5′ GCACTCGG CTTCCAGTATG 3′), NKX2.1 (forward, 5′ ACGCCGATCTTGTTGGATGTA 3′ and reverse 5′ GGCTAAAACAAACGCGAGGC 3′), and CPM (forward, 5′ GCTGTTGCTGCCTTTGGTAG 3′ and reverse 5′ GGCAACAGTCTTCAAAAACGC 3′).

5. Flow cytometry

Flow cytometric analysis of SOX17, FOXA2, and SOX2 expression in endoderm cells from AT2 and UCB iPSCs was performed. The cells were fixed using BD Cytofix/Cytoperm Fixation and Permeabilization Solution (cat. 51-2090 KE; BD Biosciences, Franklin Lakes, NJ, USA) for 15 minutes at room temperature. All subsequent washing steps were performed in PBS, and centrifugation was performed at 300×g for 3 minutes to obtain cell pellets. Each cell was permeabilized and blocked in 0.5% TritonX-100 in PBS for 30 minutes, followed by washing. The cells were incubated with primary antibodies (1:200-500 diluted in 50 µL of PBS), Anti-CXCR4 (cat. ab58176; Abcam Inc.), anti-SOX17 (cat. MAB19241; R&D Systems, Minneapolis, MN, USA), anti-FOXA2 (cat. ab108422; Abcam Inc.), and anti-SOX2 (cat. ab97959; Abcam Inc.). Secondary antibodies were 1:500 diluted in 50 µL of PBS for SOX17, FOXA2, and SOX2. Goat anti-rabbit Alexa Fluor488 and goat anti-mouse Alexa Fluor546 were added, and the cells were incubated for 20 minutes in the dark. Finally, the cells were passed through a 35-µm cell strainer cap in a 5 mL round-bottom Falcon tube (cat. 352235; Corning Incorporated) to prevent the blocking of fluorescence-activated cell sorting (FACS) lines by cell aggregates. Samples were analyzed using a BD FACS Canto II (BD Biosciences).

Results

1. Characterization of AT2 and UCB iPSCs

Before generating alveolar organoids, we generated AT2 iPSCs and showed that they could be a good candidate material for alveolar organoids. First, human lung tissue-derived AT2 cells were reprogrammed into iPSCs using the Sendai viral transduction method, as previously described in detail. To confirm that the AT2 iPSC cell line is a suitable cell source to obtain alveolar organoids, we utilized an iPSC cell line comparable to UCB iPSCs, specifically the CMC iPSC cell line mentioned in several other studies involving cell sources for brain and kidney organoids [23,24]. Therefore, 2 independent cell lines were analyzed for their pluripotency. We examined the similarities in iPSC characterization between iPSCs using various methods, including cell culture morphology, immunostaining, and RT-PCR analysis of iPSC-specific marker expression. Both AT2 iPSCs and UCB iPSCs displayed typical iPSC characteristics, such as a round shape, large nucleus, scant cytoplasm, and the formation of sharp-edged, flat, and tightly packed colonies. Each iPSC line was maintained for 20 passages without any noticeable phenotypic changes (Fig. 1A). The expression of iPSC-specific markers was determined at both the gene and protein levels. Both AT2 and UCB iPSCs expressed OCT3/4, SSEA4, TRA-1-60, and TRA-1-81, which are commonly used iPSC markers. Furthermore, both iPSC lines expressed genes such as OCT4, SOX2, LIN28, and NANOG at higher levels than their respective derived cells (Fig. 1B and 1C).

2. Protocol for generating alveolar organoids from AT2 and UCB iPSCs

Several recent studies have reported protocols for generating airway and alveolar organoids using iPSCs, which involve reprogramming fibroblasts [20,25,26]. Many alveolar organoid protocols also require a cell sorting step, because iPSC differentiation is not efficient enough to progress to the next cell stage (Table 2) [20,21,26,27]. Therefore, in this study, we sought to establish iPSC-derived alveolar organoids without the cell sorting step in which full compartment cells are present in a culture using AT2 and UCB iPSCs. Here, we optimized a step-by-step differentiation protocol to generate iPSC-derived alveolar organoids (Fig. 2A). First, the iPSCs were differentiated into a DE, which was induced using STEMdiff Definitive Endoderm Kit. Following efficient differentiation of DE cells, the cells were further differentiated into AFE, LP cells, AT cells, and alveolar organoids in SAGM and alveolar differentiation media. The differentiated endoderm cells from each iPSC type were maintained as single cells in a three-dimensional Matrigel dome environment and were induced to differentiate into alveolar organoids (Fig. 2B). As a result, differentiation continued for 40 days, and alveolar organoids were successfully formed (Fig. 2B) in AT2 iPSC-origin cells.

3. Comparison of alveolar organoids from AT2 and UCB iPSCs

We investigated how different iPSC cell lines differentiated into alveolar organoids using the same protocol. When placed into this culture system, alveolar spheroids derived from cultured AT2 iPSCs developed into alveolar organoids in the Matrigel dome, but UCB iPSCs did not form spheroids (Fig. 3A). The alveolar organoids derived from AT2 iPSCs expressed the type 1 alveolar markers caveolin-1 and aquaporin 5, as well as the type 2 alveolar marker HT2-280, whereas these markers were not expressed in UCB iPSC-derived organoids (Fig. 3B). These results suggest that the source of iPSCs can affect the differentiation process and the resulting final differentiated alveolar cell types. To understand the response of each iPSC line in differentiating alveolar organoids cultured using the same protocol, we began by testing conditions to improve DE differentiation efficiency. To determine whether this difference occurred when each iPSC differentiated into DE cells, we compared the gene and protein expression of endoderm markers. Using flow cytometry with SOX17, FOXA2, and SOX2 to quantitate cell composition, we observed no difference in the expression of the protein markers SOX17 and FOXA2 in either cell line. SOX2-positive cell populations are candidates for bud tip-like progenitors, a developmentally transient progenitor population for airway and alveolar cell types. The expression of SOX2 protein was higher in AT2 iPSCs (72.6%) than in UCB iPSCs (5.1%) at the DE stage (Fig 3C). Then we performed additional experiments assessing the protein CXCR4 using flow cytometry in the ED stage. The analysis revealed a higher abundance of CXCR4 protein in AT2 iPSCs (84.3%) have a greater component of proteins associated with lung development compared to UCB iPSCs (1.3%) (Fig 3C). These cells already have a potential committed progenitor to the differentiated foregut stage when triggered by specific cytokines. Under the same cell conditions, each ED cell was analyzed using RT-PCR. The expression difference of endoderm marker CXCR4 showed a statistically significant variation , and the expression of other genes (SOX17, FOXA2, and SOX2 was slightly higher in the differentiated endoderm cells compare to their respective iPSCs (Fig 3D).
Although the protein expression of SOX2 differed between AT2 and UCB iPSCs, there was no significant difference in the gene expression of SOX2 in differentiated endoderm cells (Fig. 3C and 3D). The higher protein expression of SOX2 in AT2 iPSCs suggests that the cells were already committed progenitors of the AFE, as reflected by the similar RNA levels between the 2 iPSC types. The expression of lung progenitor genes, such as NKX2.1 and CPM, was significantly higher in endoderm cells differentiated from AT2 iPSCs than in those differentiated from UCB iPSCs (Fig. 3D). The results strongly suggested that, based on the gene expression data and the observed differences in alveolar organoid formation and protein marker expression, the differentiation of AT2 iPSCs appeared to be more committed toward the alveolar cell lineage than UCB iPSCs. This may explain the observed differences in organoid formation and marker expression between the 2 cell types.

Discussion

Organoids are currently one of the most actively researched areas and can be used for drug discovery and cell therapy [7,28]. Although there are various methods for organoid preparation, iPSCs have been selected for generating alveolar organoids. However, their production is less efficient and more time-consuming compared to primary adult stem cells. Researchers are now working on developing a novel protocol for constructing alveolar organoids using iPSCs. The recently established protocol for alveolar organoids involves differentiating iPSCs in two-dimensional culture up to the AFE or lung progenitor stage, followed by three-dimensional culture using Matrigel or another extracellular matrix [14,20,27,29-31].
In this study, we sought to differentiate iPSCs into alveolar organoids by initially employing two-dimensional culture up to the endoderm stage, followed by a transition to three-dimensional culture, as illustrated in Fig. 2. Upon transitioning to the three-dimensional culture, alveolar organoids were generated by altering the differentiation medium after 7 days of re-doming. According to our protocol, the efficiency of producing alveolar organoids can vary based on the cell origin of the iPSCs. In this instance, AT2 iPSCs demonstrated significantly greater efficiency in generating alveolar organoids compared to UCB iPSCs, as depicted in Fig. 3. Consequently, the differentiation of UCB iPSCs into alveolar organoids failed to form spheroids, in contrast to the successful differentiation of AT2 iPSCs. We conducted flow cytometry and RT-PCR analyses to ascertain whether differences in expression at the endoderm stage might contribute to the varying efficiencies of alveolar organoid formation between AT2 and UCB iPSCs. By comparing gene and protein expression between the 2 types of iPSCs, we discovered that AT2 iPSCs exhibited higher expression of genes and proteins associated with the subsequent stage of endoderm development, indicating that they differentiated into alveolar organoids more efficiently than UCB iPSCs. These findings suggest that the efficiency of generating alveolar organoids from iPSCs is dependent on the cell lineage and that there were differences in gene expression and developmental potential between AT2 and UCB iPSCs. These distinctions may account for the observed disparities in organoid formation, rendering the process both simple and rapid.

NOTES

Conflict of interest

No potential conflict of interest relevant to this article was reported.

Funding

This research was supported by the Bio & Medical Technology Development Program of the National Research Foundation (NRF) funded by the Korean government (MTIS) (NRF-2019M3A9H2032423, NRF-2019M3A9H2032424) and the Basic Science Research Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Education (NRF-2021R1I1A1A01059764).

Authors’ contributions

Conceptualization: MJL, AJ, SWK; Data curation: MJL, AJ; Formal analysis: MJL, AJ; Funding acquisition: MJL, AJ; Investigation: MJL, AJ; Methodology: MJL, AJ; Project administration: MJL, AJ, SWK; Resources: AJ, SWK; Supervision: AJ, SWK; Validation: AJ, SWK; Visualization: MJL, AJ; Writing-original draft: MJL, AJ; Writing-review & editing: MJL, AJ, SWK.

Data availability

Please contact the corresponding author for data availability.

Acknowledgments

We gratefully acknowledge YiPSCELL Corporation for providing the induced pluripotent stem cell line “CMC11” used in this study.

Fig. 1.
Characterization of induced pluripotent stem cells (iPSCs) derived from alveolar type (AT) cells and umbilical cord blood (UCB) cells. (A) Morphology of iPSCs derived from AT cells and UCB cells, assessed using microscopy with bright-field images. (B) AT2 iPSCs and UCB iPSCs immunoassayed for iPSC-specific markers (OCT3/4, SSEA4, TRA-1-60, and TRA-1-81). (C) mRNA expression levels of the iPSC reprogramming factors in AT2 iPSCs compared to AT2 stem cells, which was assessed using real-time polymerase chain reaction. Data are presented as mean±standard deviation. Independent replicates=3, **p<0.001, two-sided t-test.
organoid-2023-3-e11f1.jpg
Fig. 2.
Characterization of induced pluripotent stem cells (iPSCs) derived from alveolar type (AT) cells and umbilical cord blood (UCB) cells. (A) Schematic overview of the alveolar organoid generating protocol for human iPSCs. It is shown processing for development of iPSCs into definitive endoderm (DE), anterior foregut endoderm (AFE), lung progenitor (LP), alveolar type cells (AT), and alveolar organoids (AO) that presenting suitable culture medium for during organoid culture. (B) Representative phase contrast images for iPSC derived alveolar organoids, including morphology of iPSCs, DE cells, embedded DE cells in Matrigel and alveolar organoid.
organoid-2023-3-e11f2.jpg
Fig. 3.
Comparison of alveolar organoid derived from AT2 iPSCs and UCB iPSCs. (A) Morphology of alveolar organoids generated from AT2 and UCB iPSCs. (B) The alveolar organoids iPSCs immunoassayed for the type 2 alveolar marker (HT2-280) and type 1 alveolar specific markers (CAV, caveolin-1; Aqua5, aquaporin 5). (C) Flow cytometry in DE cells derived from AT2 and UCB iPSCs with DE markers (CXCR4, SOX17, FOXA2) and anterior foregut endoderm (AFE) marker SOX2, non-fluorescing cells were used as a negative control (incubated with only secondary antibodies). (D) Differential gene expression analyses by real-time polymerase chain reaction with DE cells derived from AT2 and UCB iPSCs. Gene markers of DE (CXCR4, SOX17, FOXA2), AFE (SOX2) and LP (NKX2.1, CPM). All data expressed as mean±standard deviation. AT, alveolar type; iPSC, induced pluripotent stem cell; UCB, umbilical cord blood; DE, definitive endoderm; AFE, anterior foregut endoderm; LP, lung progenitor. Independent replicates=3, **p<0.001, unpaired two-tailed t-test).
organoid-2023-3-e11f3.jpg
Table 1.
Alveolar differentiation medium component
Reagent Manufacturer Cat. Final concentration
Ham’s F12 (mL) Gibco 11765054 500
Dexamethasone (nM) Sigma-Aldrich D4902 50
3-Isobutyl-1-methylxanthine (IBMX) (µM) Sigma-Aldrich I5879 100
B27 supplement (%) Gibco 17504004 2
N2 supplement (%) Gibco 17502048 1
7.5% Bovine serum albumin Farnction ⅴ (%) Gibco 15260037 1
HEPES (mM) Gibco 15630080 15
CaCl2 (mM) Sigma-Aldrich 21115 0.8
8-BrcAMP (µM) Sigma-Aldrich B7880 100
Recombinant Human KGF (ng/mL) PeproTech 100-19 10
Recombinant Human FGF-10 (ng/mL) PeproTech 100-26 10
Anti antibiotic-antimycotic (%) Gibco 15240096 1
Table 2.
Difference of protocols between recently presented and our study
iPSCs origin Method Cell sorting step required Time required for organoid generation Reference info.
Recently presented protocols Fibroblast Differentiation in 2D culture iPSC-definitive endoderm-AFE or lung progenitor Yes 29 d-6 wk [20,21,26,27]
Our study Alveolar cell, Lung tissue dissociation cells Differentiation in 2D culture iPSC-definitive endoderm No 40 d

iPSC, induced pluripotent stem cell; 2D, two-dimensional; AFE, anterior foregut endoderm.

References

1. Global Initiative for Chronic Obstructive Lung Disease (GOLD). Pocket guide to COPD diagnosis, management, and prevention: a guide for health care professionals: 2019 edition [Internet]. Deer Park: GOLD; 2019 [cited 2023 Mar 15]. Available from: https://goldcopd.org/wp-content/uploads/2018/11/GOLD-2019-POCKET-GUIDE-DRAFT-v1.7-14Nov2018-WMS.pdf.
2. Chanda D, Otoupalova E, Smith SR, Volckaert T, De Langhe SP, Thannickal VJ. Developmental pathways in the pathogenesis of lung fibrosis. Mol Aspects Med 2019;65:56-69.
crossref pmid
3. Shenderov K, Collins SL, Powell JD, Horton MR. Immune dysregulation as a driver of idiopathic pulmonary fibrosis. J Clin Invest 2021;131:e143226.
crossref pmid pmc
4. World Health Organization (WHO). The top 10 causes of death: leading causes of death globally [Internet]. Geneva: WHO; 2020 Dec 9 [cited 2023.03.15]. Available from: https://www.who.int/news-room/fact-sheets/detail/the-top-10-causes-of-death..
5. Yhee JY, Im J, Nho RS. Advanced therapeutic strategies for chronic lung disease using nanoparticle-based drug delivery. J Clin Med 2016;5:82.
crossref pmid pmc
6. Lancaster MA, Knoblich JA. Organogenesis in a dish: modeling development and disease using organoid technologies. Science 2014;345:1247125.
crossref pmid
7. Bock C, Boutros M, Camp JG, Clarke L, Clevers H, Knoblich JA, et al. The organoid cell atlas. Nat Biotechnol 2021;39:13-7.
crossref pmid pdf
8. Dutta D, Heo I, Clevers H. Disease modeling in stem cell-derived 3D organoid systems. Trends Mol Med 2017;23:393-410.
crossref pmid
9. Choi J, Iich E, Lee JH. Organogenesis of adult lung in a dish: differentiation, disease and therapy. Dev Biol 2016;420:278-86.
crossref pmid
10. Dye BR, Hill DR, Ferguson MA, Tsai YH, Nagy MS, Dyal R, et al. In vitro generation of human pluripotent stem cell derived lung organoids. Elife 2015;4:e05098.
crossref pmid pmc pdf
11. Barkauskas CE, Chung MI, Fioret B, Gao X, Katsura H, Hogan BL. Lung organoids: current uses and future promise. Development 2017;144:986-97.
crossref pmid pmc pdf
12. Green MD, Chen A, Nostro MC, d’Souza SL, Schaniel C, Lemischka IR, et al. Generation of anterior foregut endoderm from human embryonic and induced pluripotent stem cells. Nat Biotechnol 2011;29:267-72.
crossref pmid pmc pdf
13. Bluhmki T, Traub S, Müller AK, Bitzer S, Schruf E, Bammert MT, et al. Functional human iPSC-derived alveolar-like cells cultured in a miniaturized 96‑Transwell air-liquid interface model. Sci Rep 2021;11:17028.
crossref pmid pmc pdf
14. Huang SX, Green MD, de Carvalho AT, Mumau M, Chen YW, D’Souza SL, et al. The in vitro generation of lung and airway progenitor cells from human pluripotent stem cells. Nat Protoc 2015;10:413-25.
crossref pmid pmc pdf
15. Nikolić MZ, Caritg O, Jeng Q, Johnson JA, Sun D, Howell KJ, et al. Human embryonic lung epithelial tips are multipotent progenitors that can be expanded in vitro as long-term self-renewing organoids. Elife 2017;6:e26575.
pmid pmc
16. Miller AJ, Hill DR, Nagy MS, Aoki Y, Dye YBR, Chin AM, et al. In vitro induction and in vivo engraftment of lung bud tip progenitor cells derived from human pluripotent stem cells. Stem Cell Reports 2018;10:101-19.
crossref pmid
17. Miller AJ, Yu Q, Czerwinski M, Tsai YH, Conway RF, Wu A, et al. In vitro and in vivo development of the human airway at single-cell resolution. Dev Cell 2020;53:117-28.
crossref pmid pmc
18. Conway RF, Frum T, Conchola AS, Spence JR. Understanding human lung development through in vitro model systems. Bioessays 2020;42:e2000006.
crossref pmid pmc pdf
19. Regev A, Teichmann SA, Lander ES, Amit I, Benoist C, Birney E, et al. The human cell atlas. Elife 2017;6:e27041.
crossref pmid pmc pdf
20. Hein RF, Conchola AS, Fine AS, Xiao Z, Frum T, Brastrom LK, et al. Stable iPSC-derived NKX2-1+ lung bud tip progenitor organoids give rise to airway and alveolar cell types. Development 2022;149:dev200693.
crossref pmid pmc pdf
21. Yamamoto Y, Gotoh S, Korogi Y, Seki M, Konishi S, Ikeo S, et al. Long-term expansion of alveolar stem cells derived from human iPS cells in organoids. Nat Methods 2017;14:1097-106.
crossref pmid pdf
22. Rim YA, Park N, Nam Y, Ham DS, Kim JW, Ha HY, et al. Recent progress of national banking project on homozygous HLA-typed induced pluripotent stem cells in South Korea. J Tissue Eng Regen Med 2018;12:e1531-6.
pmid
23. Lim JY, Lee JE, Kim HK, Park YJ, Jeon JH, Park SA, et al. Human palatine tonsils are linked to Alzheimer’s disease through function of reservoir of amyloid beta protein associated with bacterial infection. Cells 2022;11:2285.
crossref pmid pmc
24. Kim JW, Nam SA, Seo E, Lee JY, Kim D, Ju JH, et al. Human kidney organoids model the tacrolimus nephrotoxicity and elucidate the role of autophagy. Korean J Intern Med 2021;36:1420-36.
crossref pmid pmc pdf
25. Jacob A, Morley M, Hawkins F, McCauley KB, Jean JC, Heins H, et al. Differentiation of human pluripotent stem cells into functional lung alveolar epithelial cells. Cell Stem Cell 2017;21:472-88.
crossref pmid pmc
26. Demchenko A, Lavrov A, Smirnikhina S. Lung organoids: current strategies for generation and transplantation. Cell Tissue Res 2022;390:317-33.
crossref pmid pmc pdf
27. Chen YW, Huang SX, de Carvalho AL, Ho SH, Islam MN, Volpi S, et al. A three-dimensional model of human lung development and disease from pluripotent stem cells. Nat Cell Biol 2017;19:542-9.
crossref pmid pmc pdf
28. Xia X, Li F, He J, Aji R, Gao D. Organoid technology in cancer precision medicine. Cancer Lett 2019;457:20-7.
crossref pmid
29. He Y, Rofaani E, Huang X, Huang B, Liang F, Wang L, et al. Generation of alveolar epithelium using reconstituted basement membrane and hiPSC-derived organoids. Adv Healthc Mater 2022;11:e2101972.
crossref pmid pdf
30. Spitalieri P, Centofanti F, Murdocca M, Scioli MG, Latini A, Di Cesare S, et al. Two different therapeutic approaches for SARS-CoV-2 in hiPSCs-derived lung organoids. Cells 2022;11:1235.
crossref pmid pmc
31. Suezawa T, Kanagaki S, Moriguchi K, Masui A, Nakao K, Toyomoto M, et al. Disease modeling of pulmonary fibrosis using human pluripotent stem cell-derived alveolar organoids. Stem Cell Reports 2021;16:2973-87.
crossref pmid pmc
TOOLS
METRICS Graph View
  • 1 Crossref
  •  0 Scopus
  • 1,487 View
  • 57 Download
ORCID iDs

Min Jae Lim
https://orcid.org/0000-0002-0847-4636

Ayoung Jo
https://orcid.org/0009-0003-1149-5627

Sung-Won Kim
https://orcid.org/0000-0002-8981-2536

Related articles


ABOUT
BROWSE ARTICLES
EDITORIAL POLICY
FOR CONTRIBUTORS
Editorial Office
Room 319, Hall 1 of Chonbuk National University Dental College, 20, Geonji-ro, Deokjin-gu, Jeonju 54907, Korea
Tel: +82-63-270-4024    E-mail: editor@j-organoid.org                

Copyright © 2024 by The Organoid Society.

Developed in M2PI

Close layer
prev next