Organoid > Volume 4; 2024 > Article
Jeong, Cho, and Ko: ERdj5-mediated regulation of proliferation and differentiation in colon organoids under inflammatory stress

Abstract

Background

Endoplasmic reticulum (ER) stress is resolved by ER DnaJ domain-containing protein 5 (ERdj5), which functions as a disulfide reductase. In a previous study, we confirmed that ERdj5 was not indispensable for the formation of intestinal epithelial cells in mice. However, studies evaluating the association of ERdj5 and growth factors are limited. In the present study, we observed changes in the proliferation of colon organoids cultured from intestinal crypts obtained from wild-type (WT) and ERdj5 knockout (KO) mice.

Methods

We cultured colon organoids from WT and ERdj5 KO mice, and we then assessed differentiation- and proliferation-related markers after exposure to various stimuli, such as irradiation and the Toll-like receptor (TLR) 2 ligand Pam3CSK4.

Results

Over 15 days of organoid culture, ERdj5 KO colon organoids demonstrated a similar increase in leucine-rich repeat-containing G-protein-coupled receptor 5 (Lgr5) expression as WT colon organoids. However, in response to Pam3CSK4-induced stress, the ERdj5 KO organoids exhibited decreased Lgr5 expression and increased C/EBP homologous protein (CHOP) levels. Moreover, after irradiation-induced stress, ERdj5 downregulated epithelial-related genes, including Lgr5, Villin 1, and Prominin 1.

Conclusion

Inflammation through irradiation or TLR2-induced mild or severe ER stress in both groups, whereas ERdj5 deficiency eventually led to the downregulation of Lgr5. In summary, these findings suggest that colon organoids lack the ability to mount an effective defense against various inflammatory stimuli when there is a deficiency in the ERdj5-related ER stress resolution pathway.

Introduction

Intestinal epithelial cells (IECs), which comprise functional cells such as goblet cells and Paneth cells, play a crucial role in maintaining intestinal homeostasis [1,2]. In addition to their essential functions such as absorption of water and nutrients, IECs serve as physical and chemical barriers, protecting the internal environment from symbiotic microbial insults [1,3,4]. To sustain these barrier functions, IECs engage in continuous replenishment, originating from intestinal stem cells that undergo self-renewal every 4 to 5 days [3]. During the process of self-renewal in IECs, Lgr5+ stem cells differentiate into transit-amplifying (TA) cells [5]. Subsequently, these TA progenitor cells sequentially adopt the fates of secretory cells, such as goblet, Paneth, and enteroendocrine or absorptive enterocyte cells [5]. Therefore, maintaining the proper balance of IECs is essential for preserving normal intestinal function. The intestine is a structurally complex organ that is suitable for reproduction through the organoid technique [6,7]. In addition, colon organoids can replicate the typical histological features of stem cell-based organs [8]. With their capacity for functional cell differentiation, colon organoids are extensively used in various research fields, including studies of the microbiome, disease mechanisms, and drug discovery [8-11].
Leucine-rich repeat-containing G-protein-coupled receptor 5 (Lgr5) is a G protein-coupled receptor (GPCR) and a stem cell marker recognized in various organs, including the small intestine [12]. Furthermore, Lgr5 recognizes R-spondins on the cell membrane [13] and is associated with the initiation of the Wnt/β-catenin signaling pathway and regulation of tissue homeostasis and stem cell biology [14,15]. Conversely, a decrease in Lgr5 expression under endoplasmic reticulum (ER) stress is observed in human colorectal cancer [16]. In particular, protein kinase RNA-like ER kinase (PERK) is more closely related to Lgr5 depletion than other ER-sensing proteins, such as inositol-requiring enzyme 1 (IRE1) and activating transcription factor 6 (ATF6) [16]. In a previous study, ER DnaJ domain-containing protein 5 (ERdj5) deficiency increased PERK-related ER stress under inflammatory conditions, leading to cell apoptosis [17]. However, the correlation between ERdj5 and Lgr5 expression in the intestinal epithelium remains unclear.
The ER DnaJ domain-containing protein 5 (ERdj5), a disulfide reductase in the ER, moderates the processing of misfolded proteins [18]. The accumulation of unfolded or misfolded proteins inside the ER due to various factors induces stress [19,20]. Moreover, ER stress is caused by excessive nutrient accumulation, irradiation, and infection and is known to be especially related to inflammation [21-23]. In a previous study, it was established that while ERdj5 does not pose any issues concerning the growth of IECs, the protein leads to excessive ER stress and subsequent apoptosis in certain specialized cells, particularly goblet cells, when exposed to inflammatory conditions [17]. Additionally, irradiation induces ER stress by producing reactive oxygen species (ROS) [24]. Furthermore, ER signaling proteins such as ATF6, PERK, and IRE1 are activated by irradiation-induced ER stress. Autophagy, the DNA damage response, and the ROS stress response are affected by ER stress [25].
In this study, we cultured colon organoids (colonoids) using a crypt obtained from the colon epithelium and hypothesized that the ER-related protein ERdj5 affects proliferation markers in IECs.

Materials and Methods

Ethics statement: All experiments were performed following the guidelines and protocols approved by the Institutional Animal Care and Use Committee of Kangwon National University (IACUC, KW-210610-5).

1. Mice

Female C57BL/6 mice and ERdj5 deficient mice were purchased as previously described [17]. All the mice were bred at the Kangwon National University Animal Laboratory Center.

2. Organoid culture

Murine colonic organoids were cultured as previously described [26]. Briefly, mouse colonic tissues were washed to eliminate the gut microbiota, and dissociated colonic crypts were used as a recovery solution. Finally, intestinal crypts were plated in 50% Matrigel and filled with colon organoid growth medium (Dulbecco's Modified Eagle Medium F/12; Gibco, Carlsbad, CA, USA), 50% L-WRN growth medium, B27 (Gibco), N2 (Gibco), 1.25 mM N-acetylcysteine (Sigma Aldrich, St. Louis, MO, USA), 10 mM nicotinamide (Sigma Aldrich), 10 μM P38i (Sigma Aldrich), 16.7 pM mEGF (Invitrogen, Vienna, Austria), 10 μM Y-27632 (Abmole, Houston, TX, USA), and 0.5 μM A83-01 (Tocris, Bristol, UK). The colon organoid growth medium was replaced every 2 days, and the colonoids were passaged every 7 days. Colon organoids were observed using Nikon Eclipse Ts2 (Nikon, Minato, Tokyo, Japan).

3. Organoid stress induction

Colonoids were incubated for 48 hours at 37°C on day 7 with 1 µg/mL of Pam3CSK4 (InvivoGen, San Diego, CA, USA), an agonist of Toll-like receptor (TLR)2/TLR1, to mimic inflammatory conditions.
Radiation exposure experiments inducing cell stress in colonoids were performed as previously described. In brief, we treated the colonoids after 3 days of culture with a 6 Gy dose of γ-radiation using Gammacell 40 Exactor (Best Theratronics, Ottawa, ON, Canada). After radiation treatment, the colonoids were incubated at 37℃ for 4 days.

4. Quantitative real-time polymerase chain reaction

Total RNA was extracted from the colon organoids using the TRIzol reagent (Ambion, Austin, TX, USA). RNA quality was confirmed using an ultraviolet-visible spectrophotometer (MicroDigital, Seongnam, Korea). The RNA was reverse-transcribed using the Goscript Reverse Transcription System (Promega, Madison, WI, USA). Additionally, quantitative real-time polymerase chain reaction (qRT-PCR) was performed using GoTaq® qPCR and RT-qPCR Systems (Promega) by CFX96 Touch Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA). The primers used for qPCR were in Table 1.

5. Immunofluorescence staining

Colon organoids were fixed in 4% paraformaldehyde and permeabilized with 2% Triton-X100 (Sigma Aldrich). Nonspecific antibody binding to the organoid surface was blocked with 3% bovine serum albumin (MP Biomedicals, Solon, OH, USA) in phosphate-buffered saline. To assess colon cell death, the ApopTag Fluorescein In Situ Apoptosis Detection Kit (Merck, Kenilworth, NJ, USA) was used for the terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay. The colonoids were then mounted with a Fluoroshield with 4′,6-diamidino-2-phenylindole (Sigma) to visualize the nuclei. Organoid images were visualized using a confocal laser scanning microscope (LSM880; Carl Zeiss, Göttingen, Germany) and analyzed using the ZEN program (Carl Zeiss).

6. Statistical analysis

GraphPad Prism 10 (San Diego, CA, USA) was used for data analysis. Differences between the 2 groups were analyzed using the t-test. One-way analysis of variance and post-hoc tests were also performed. The Tukey multiple-comparison test was utilized for comparisons of more than 2 groups. A threshold of p<0.05 was deemed statistically significant.

Results

1. Phenotype changes in the in vitro developmental process of colon organoids

We cultured an equal number of crypts (5×102/well) from the ERdj5 wild-type (WT)/ knockout (KO) mice colon and changed the medium every 2 days while observing the growth of the organoids for 15 days (Fig. 1A). We observed the morphology of the organoids at the indicated time points and obtained RNA to observe changes in gene expression (Fig. 1B). As observed in the colonoid images, no apparent differences in the early stages of growth were noted; however, from day 7, the ERdj5 KO organoids were smaller than the WT organoids. Moreover, Lgr5 levels on the indicated dates rapidly increased until day 7 in both the ERdj5 WT and KO groups, followed by a significant decrease thereafter (Fig. 1C). However, no significant difference in Lgr5 and Ki67 expression was observed between WT and ERdj5 KO organoids (Fig. 1C). We investigated differentiation because we did not observe significant differences in growth factors between ERdj5 WT and KO colon organoids over 15 days.

2. Genetic changes associated with differentiation

Previous studies have confirmed the appearance of differentiation-related characteristics that confer colonic identity on days 7 and 10 [27]. To evaluate the organoids, we analyzed budding on days 7 and 10. We observed that ERdj5 KO organoids formed fewer complex crypt-like structures than WT organoids (Fig. 2A). Furthermore, when evaluating the degree of differentiation on day 7 using microscopy, we observed that the level of differentiation per well was less pronounced in ERdj5 KO mice than in WT mice (Fig. 2B). Next, we confirmed the presence of RNA in functional cells that constitute the colon. The mucin 2 (Muc2) marker in goblet cells and lysozyme 1 (Lyz1) marker in Paneth cells demonstrated no significant differences between the groups. However, the enterocyte marker Villin 1 (Vil1) and the TA cell marker Prominin 1 (Prom1) exhibited lower levels in ERDj5 KO colonoids on day 7 than in WT colonoids (Fig. 2C). Collectively, the absence of ERdj5 resulted in reduced organoid differentiation.

3. Comparison of changes in response to Pam3CSK4-induced inflammatory stimulation between ERdj5 WT and ERdj5 KO organoids

ER stress modulates the levels of Lgr5, a prominent stem cell marker and a key factor in organoid growth [28]. As reported in our previous study, we induced inflammation using Pam3CSK4 (a TLR2 ligand) and observed external structural collapse, increased C-X-C motif chemokine ligand 1 secretion, and goblet cell depletion [17]. We investigated the impact of ERdj5 on functional cells such as Paneth cells and goblet cells in IECs; however, the influence of ERdj5 on the differentiation of stem cells into functional cell types remains unknown. Therefore, we aimed to investigate the effect of ERdj5 deficiency on growth factors in differentiated organoids by inducing TLR2-mediated inflammation. After 7 days of growth, colonoids were incubated for 48 hours at 37°C with 1 µg/mL of Pam3CSK4, which led to structural rupture in ERdj5-deficient organoids, unlike WT organoids (Fig. 3A). Similarly, as displayed in Fig. 3A, ERdj5 deficiency increased the number of TUNEL-positive cells (Fig. 3B). We examined various inflammation-related factors at the RNA level; however, no significant differences were identified except in interleukin-1 beta (Fig. S1). However, an increase in the PERK-related protein C/EBP homologous protein (CHOP) provided insight into the occurrence of cell apoptosis (Fig. 3C). Additionally, induction of ER stress was associated with a significant decrease in Lgr5 expression (Fig. 3D). Pam3CSK4 treatment induced ER stress, resulting in the exacerbation of apoptosis and stemness in organoids with ERdj5 deficiency.

4. Comparison between WT and ERdj5 KO organoids concerning ROS-associated inflammation

Irradiation induces ER stress by directly or indirectly generating ROS [25]. We induced ER stress through another pathway to investigate how ERdj5 affects organoid growth. A previous study found that radiation with an intensity greater than 6 Gy resulted in the loss of budding and morphology maintenance in organoids [29]. Following this reference, we cultured organoids for 3 days and then irradiated them with 6 Gy to investigate the changes occurring. In ERdj5-deficient organoids, no expansion was observed, resulting in smaller organoids than the WT organoids (Fig. 4A). In WT organoids, Lgr5 exhibited a significant increase 4 days after irradiation, whereas, in ERdj5 KO organoids, no significant increase was observed (Fig. 4B). After irradiation, the markers Prom1, Vil1, and Ki67 decreased in ERdj5 KO organoids compared to WT organoids, indicating a decline before their differentiation into functional cells from stem cells. However, no significant differences were observed in the ER stress initiator binding immunoglobulin protein (BiP) after irradiation. Collectively, inflammation through irradiation induced mild ER stress in both groups, whereas ERdj5 deficiency eventually led to the downregulation of Lgr5. The colonoids were unable to defend against various inflammatory stimuli owing to a deficiency of the ERdj5-related ER stress resolution pathway.

Discussion

The growth of organoids follows a sequence of processes, including the collection of initial cells and stem cells, proliferation, migration, and finally differentiation [8]. Although we observed no morphological differences up to day 5 in previous studies, we did not investigate the changes that occurred within the organoids during differentiation.
In this study, we identified genetic changes associated with the proliferation and differentiation of IECs in mouse colon organoids. No significant differences were identified in proliferation-related markers, such as Lgr5 and Ki67, under steady-state conditions. However, ERdj5-deficient organoids reduced the expression of the epithelial marker Vil1 and the TA cell marker Prom1. Moreover, no noticeable differences were observed in the expression of the aforementioned markers, Muc2 for goblet cells and Lyz1 for Paneth cells. However, additional research is necessary to explore potential changes in other functional cell genes.
Additionally, ER stress induces stemness in IECs [30]. We utilized the TLR2 ligand Pam3CSK4 and irradiation as pathways for inducing ER stress. In our previous study, we identified that TLR2 treatment led to preferential apoptosis of goblet cells [17]. In this study, we observed increased apoptosis and CHOP gene expression in ERdj5 KO colonoids. Furthermore, we observed a significant decrease in Lgr5 following Pam3CSK4 treatment. Increases in the expression of various inflammatory genes were observed; however, no significant differences were present between the WT and ERdj5 KO colonoids. Radiation exposure induces ER stress by triggering intracellular ROS [25]. In a previous study, exposure of organoids to a radiation dose of 6 Gy did not exhibit significant effects on organoid growth [29]. We did not observe any differences in the expression of the ER stress initiator gene BiP after radiation exposure. However, Prom1 and Lgr5 were expressed at significantly lower levels in ERdj5 KO mice than in WT mice after irradiation. The absence of ERdj5 appeared to lead to growth issues in organoids following irradiation.
Colon organoids must maintain their proper growth and differentiation [8]. If homeostasis is not sustained, cells may undergo apoptosis [31]. During the early stages of colon organoid development, the presence of ERdj5 is not considered crucial. However, as differentiation is initiated, ER stress appears to render the maintenance of homeostasis more vulnerable. Although additional research is necessary, our findings highlight the importance of ER stress regulation in colon organoid growth. This indicated that the absence of ERdj5 under stress could make colon organoids more susceptible to differentiation and growth challenges.

Supplementary Information

Supplementary materials are presented online (available at https://doi.org/10.51335/organoid.2024.4.e3).

Fig. S1.

Changes in the expression of various genes in ERdj5 WT and KO colon organoids under inflammatory conditions. (A) mRNA expression of interleukin (IL)-6, CCL2, IL-1β, and TNF-α in Pam3CSK4-treated colon organoids (n=4). (B) mRNA expression in irradiated colon organoids exposed to 6 Gy (n=3-6). Data are represented as mean±standard error of the mean. WT, wild-type; KO, knockout. *p<0.05; one-way ANOVA followed by the Tukey test.
organoid-2024-4-e3-Supplementary-Fig-1.pdf

NOTES

Conflict of interest

Hyun-Jeong Ko has been the Editorial Board member of the Organoid Society since 2024. No potential conflict of interest relevant to this article was reported.

Funding

This research was supported by the National Research Foundation of Korea (NRF) grant funded by the Korea government (Ministry of Education and ICT and Ministry of Science) (RS-2023-00208385) and Korea Basic Science Institute (National Research Facilities and Equipment Center) grant funded by the Ministry of Education (2022R1A6C101A739).

Authors’ contributions

Conceptualization: HJ, JC; Methodology: HJ; Project administration: HJK; Supervision: HJK; Validation: HJ, JC; Visualization: HJ, JC; Writing-original draft: HJ; Writing-review & editing: all authors.

Data availability

Please contact the corresponding author to inquire about the availability of data.

Fig. 1.
In vitro tracking of the phenotype changes in colon organoid development. ERdj5 WT/KO mice were used to obtain colon crypts containing stem cells, which were cultured for 15 days, followed by observation (n=3). (A) A schematic diagram describing the colon organoid culture method. (B) Image illustrating the growth of colon organoids on indicated days, with or without ERdj5 (×200, scale bar: 50 µm); (C) Levels of Lgr5 and Ki67 mRNA expression. Data are represented as mean±standard error of the mean. WT, wild-type; KO, knockout. One-way ANOVA followed by the Tukey test.
organoid-2024-4-e3f1.jpg
Fig. 2.
Comparison of differentiation and functional cell levels mediated by ERdj5 on days 7 and 10. Colon crypts obtained from ERdj5 WT/KO mice were cultured and observed on the indicated day. (A) The number of budding formations in colon organoids on day 7 and 10 (×200, scale bar: 50 µm; n=10-26). (B) Comparison of the degree of colon organoid differentiation on day 7 (×40, scale bar: 50 µm; n=16-18). (C) Comparison of Prom1, Vil1, Muc2, and Lyz1 mRNA expression levels on day 7. Data are represented as mean±standard error of the mean. ns, not significant; WT, wild-type; KO, knockout. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001; one-way ANOVA followed by the Student t-test.
organoid-2024-4-e3f2.jpg
Fig. 3.
Comparison between ERdj5 WT/KO organoids of the changes in TLR2-related inflammation. Colon organoid following TLR2 ligand-induced inflammatory stimulation. After 5 days of colon organoid culture, the organoids were further cultured for 2 days with Pam3CSK4 at a concentration of 1 µg/mL. (A) Representative bright-field images of colon organoids in the presence or absence of Pam3CSK4 (×200, scale bar: 10 µm). (B) Representative immunofluorescence image. DAPI (blue) and TUNEL (red) (×200). (C, D) Comparison of CHOP and Lgr5 mRNA expression levels following Pam3CSK4 treatment (n=6). Data are represented as mean±standard error of the mean. WT, wild-type; KO, knockout. *p<0.05, **p<0.01, ***p<0.001; one-way ANOVA followed by the Tukey test.
organoid-2024-4-e3f3.jpg
Fig. 4.
Evaluation of inflammation-induced damage using 6 Gy irradiation in colon organoids. Colon organoids, cultured for 3 days, were exposed to 6 Gy of irradiation at 0 and 96 hours. (A) A representative bright-field image (×200, scale bar: 50 µm). (B) Levels of Lgr5, Ki67, Prom1 and Vil1 mRNA expression (n=3-6). Data are represented as mean±standard error of the mean. *p<0.05, **p<0.01, ***p<0.001; one-way ANOVA followed by the Tukey test.
organoid-2024-4-e3f4.jpg
Table 1.
qPCR primer sequences
Genes 5’-3’
GAPDH Forward GTGTCCGTGGATCTGA
Reverse CCTGCTTCACCACCTTCTTGAT
LGR5 Forward CCTACTCGAAGACTTACCCAGT
Reverse GCATTGGGGTGAATGATAGCA
MKI67(Ki67) Forward ATCATTGACCGCTCCTTTAGGT
Reverse GCTCGCCTTGATGGTTCCT
VIL1 Forward TCAAAGGCTCTCTCAACATCAC
Reverse AGCAGTCACCATCGAAGAAGC
PROM1 Forward CTCCCATCAGTGGATAGAGAACT
Reverse ATACCCCCTTTTGACGAGGCT
MUC2 Forward ATGCCCACCTCCTCAAAGAC
Reverse GTAGTTTCCGTTGGAACAGTGAA
LYZ(Lyz1) Forward GGAATGGATGGCTACCGTGG
Reverse CATGCCACCCATGCTCGAAT
DDIT3(CHOP) Forward TATCTCATCCCCAGGAAACG
Reverse GGGCACTGACCACTCTGTTT
IL6(IL-6) Forward GAGGATACCACTCCCAACAGACC
Reverse AAGTGCATCATCGTTGTTCATACA
CCL2 Forward TTAAAAACCTGGATCGGAACCAA
Reverse GCATTAGCTTCAGATTTACGGGT
IL1B(IL-1β) Forward GAAATGCCACCTTTTGACAGTG
Reverse TGGATGCTCTCATCAGGACAG
TNF(TNF-α) Forward AGCCCACGTCGTAGCAAACCAC
Reverse ACACCCATTCCCTTCACAGAGCAA
HSPA5(BiP) Forward TGTGGTACCCACCAAGAAGTC
Reverse TTCAGCTGTCACTCGGAGAAT

Indicated genes are expressed as normalized expressions against the GAPDH housekeeping gene. qPCR, quantitative polymerase chain reaction.

References

1. Kong S, Zhang YH, Zhang W. Regulation of intestinal epithelial cells properties and functions by amino acids. Biomed Res Int 2018;2018:2819154.
crossref pmid pmc pdf
2. Patterson AM, Watson AJ. Deciphering the complex signaling systems that regulate intestinal epithelial cell death processes and shedding. Front Immunol 2017;8:841.
crossref pmid pmc
3. Allaire JM, Crowley SM, Law HT, Chang SY, Ko HJ, Vallance BA. The intestinal epithelium: central coordinator of mucosal immunity. Trends Immunol 2018;39:677-96.
crossref pmid
4. Soderholm AT, Pedicord VA. Intestinal epithelial cells: at the interface of the microbiota and mucosal immunity. Immunology 2019;158:267-80.
crossref pmid pmc pdf
5. Sanman LE, Chen IW, Bieber JM, Steri V, Trentesaux C, Hann B, et al. Transit-amplifying cells coordinate changes in intestinal epithelial cell-type composition. Dev Cell 2021;56:356-65.
crossref pmid pmc
6. Hickey JW, Becker WR, Nevins SA, Horning A, Perez AE, Zhu C, et al. Organization of the human intestine at single-cell resolution. Nature 2023;619:572-84.
crossref pmid pmc pdf
7. Günther C, Winner B, Neurath MF, Stappenbeck TS. Organoids in gastrointestinal diseases: from experimental models to clinical translation. Gut 2022;71:1892-908.
crossref pmid
8. Zhao Z, Chen X, Dowbaj AM, Sljukic A, Bratlie K, Lin L, et al. Organoids. Nat Rev Methods Primers 2022;2:94.
crossref pmid pmc pdf
9. Rubert J, Schweiger PJ, Mattivi F, Tuohy K, Jensen KB, Lunardi A. Intestinal organoids: a tool for modelling diet-microbiome-host interactions. Trends Endocrinol Metab 2020;31:848-58.
crossref pmid
10. Yoo JH, Donowitz M. Intestinal enteroids/organoids: a novel platform for drug discovery in inflammatory bowel diseases. World J Gastroenterol 2019;25:4125-47.
crossref pmid pmc
11. Takahashi Y, Inoue Y, Sato S, Okabe T, Kojima H, Kiyono H, et al. Drug cytotoxicity screening using human intestinal organoids propagated with extensive cost-reduction strategies. Sci Rep 2023;13:5407.
crossref pmid pmc pdf
12. Kwon MS, Park BO, Kim HM, Kim S. Leucine-rich repeat-containing G-protein coupled receptor 5/GPR49 activates G12/13-Rho GTPase pathway. Mol Cells 2013;36:267-72.
crossref pmid pmc pdf
13. Chen Z, Xue C. G-protein-coupled receptor 5 (LGR5) overexpression activates β-catenin signaling in breast cancer cells via protein kinase A. Med Sci Monit Basic Res 2019;25:15-25.
crossref pmid pmc
14. Leung C, Tan SH, Barker N. Recent advances in Lgr5+ stem cell research. Trends Cell Biol 2018;28:380-91.
crossref pmid
15. Schindler AJ, Watanabe A, Howell SB. LGR5 and LGR6 in stem cell biology and ovarian cancer. Oncotarget 2018;9:1346-55.
crossref pmid
16. Okamoto Y, Saito T, Tani Y, Toki T, Hasebe A, Koido M, et al. The kinase PERK represses translation of the G-protein-coupled receptor LGR5 and receptor tyrosine kinase ERBB3 during ER stress in cancer cells. J Biol Chem 2020;295:4591-603.
crossref pmid pmc
17. Jeong H, Hong EH, Ahn JH, Cho J, Jeong JH, Kim CW, et al. ERdj5 protects goblet cells from endoplasmic reticulum stress-mediated apoptosis under inflammatory conditions. Exp Mol Med 2023;55:401-12.
crossref pmid pmc pdf
18. Ushioda R, Hoseki J, Araki K, Jansen G, Thomas DY, Nagata K. ERdj5 is required as a disulfide reductase for degradation of misfolded proteins in the ER. Science 2008;321:569-72.
crossref pmid
19. Haeri M, Knox BE. Endoplasmic reticulum stress and unfolded protein response pathways: potential for treating age-related retinal degeneration. J Ophthalmic Vis Res 2012;7:45-59.
pmid pmc
20. McLaughlin T, Zhang SX. The neuroprotective potential of endoplasmic reticulum chaperones. Neural Regen Res 2015;10:1211-3.
crossref pmid pmc
21. Takamura T. Remodeling of nutrient homeostasis by unfolded protein response. Diabetes 2014;63:841-3.
crossref pmid pdf
22. Park K, Lee SE, Shin KO, Uchida Y. Insights into the role of endoplasmic reticulum stress in skin function and associated diseases. FEBS J 2019;286:413-25.
crossref pmid pmc pdf
23. Cao SS, Luo KL, Shi L. Endoplasmic reticulum stress interacts with inflammation in human diseases. J Cell Physiol 2016;231:288-94.
crossref pmid
24. Zhang K, Kaufman RJ. From endoplasmic-reticulum stress to the inflammatory response. Nature 2008;454:455-62.
crossref pmid pmc pdf
25. Kim W, Lee S, Seo D, Kim D, Kim K, Kim E, et al. Cellular stress responses in radiotherapy. Cells 2019;8:1105.
crossref pmid pmc
26. Allaire JM, Poon A, Crowley SM, Han X, Sharafian Z, Moore N, et al. Interleukin-37 regulates innate immune signaling in human and mouse colonic organoids. Sci Rep 2021;11:8206.
crossref pmid pmc pdf
27. Daoud A, Múnera JO. Generation of human colonic organoids from human pluripotent stem cells. Methods Cell Biol 2020;159:201-27.
crossref pmid pmc
28. van Lidth de Jeude JF, Meijer BJ, Wielenga MC, Spaan CN, Baan B, Rosekrans SL, et al. Induction of endoplasmic reticulum stress by deletion of Grp78 depletes Apc mutant intestinal epithelial stem cells. Oncogene 2017;36:3397-405.
crossref pmid pdf
29. Montenegro-Miranda PS, van der Meer JH, Jones C, Meisner S, Vermeulen JL, Koster J, et al. A novel organoid model of damage and repair identifies hnf4α as a critical regulator of intestinal epithelial regeneration. Cell Mol Gastroenterol Hepatol 2020;10:209-23.
crossref pmid pmc
30. Heijmans J, van Lidth de Jeude JF, Koo BK, Rosekrans SL, Wielenga MC, van de Wetering M, et al. ER stress causes rapid loss of intestinal epithelial stemness through activation of the unfolded protein response. Cell Rep 2013;3:1128-39.
crossref pmid
31. Taelman J, Diaz M, Guiu J. Human intestinal organoids: promise and challenge. Front Cell Dev Biol 2022;10:854740.
crossref pmid pmc
TOOLS
METRICS Graph View
  • 0 Crossref
  •  0 Scopus
  • 1,599 View
  • 14 Download
ORCID iDs

Hyunjin Jeong
https://orcid.org/0000-0003-4386-3845

Jaewon Cho
https://orcid.org/0000-0003-0766-8858

Hyun-Jeong Ko
https://orcid.org/0000-0002-3844-928X

Related articles


ABOUT
BROWSE ARTICLES
EDITORIAL POLICY
FOR CONTRIBUTORS
Editorial Office
Room 319, Hall 1 of Chonbuk National University Dental College, 20, Geonji-ro, Deokjin-gu, Jeonju 54907, Korea
Tel: +82-63-270-4024    E-mail: editor@j-organoid.org                

Copyright © 2024 by The Organoid Society.

Developed in M2PI

Close layer
prev next